View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6999_low_9 (Length: 229)

Name: NF6999_low_9
Description: NF6999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6999_low_9
NF6999_low_9
[»] chr1 (3 HSPs)
chr1 (1-206)||(12383000-12383205)
chr1 (163-229)||(12362511-12362577)
chr1 (163-229)||(12378863-12378929)


Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 12383205 - 12383000
Alignment:
1 tcatggaaatcacaggcaacggaattgcccaaattaatatgtagagtacgtgaaagatttattacccatcaacttaatttatgaattcttttgatgcatg 100  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
12383205 tcatggaaatcaaaggcaacggaattgcccaaattaatatgtagagtacgtgaaagatatattatccatcaacttaatttatgaattcttttgatgcatg 12383106  T
101 gacccatatgttttcaaaatgactatgactattgccaaacataaccatgcaatatgcatggcaatgcaaaaatacttataccctagtcatgattttggat 200  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12383105 gacccatatgttttcaaaatgactatgattattgccaaacataaccatgcaatatgcatggcaatgcaaaaatacttataccctagtcatgattttggat 12383006  T
201 ttaagt 206  Q
    ||||||    
12383005 ttaagt 12383000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 12362577 - 12362511
Alignment:
163 aatgcaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat 229  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12362577 aatgaaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat 12362511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 12378929 - 12378863
Alignment:
163 aatgcaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat 229  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12378929 aatgaaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat 12378863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University