View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7000_high_6 (Length: 264)
Name: NF7000_high_6
Description: NF7000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7000_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 24 - 138
Target Start/End: Complemental strand, 9936187 - 9936070
Alignment:
| Q |
24 |
atgatgaattcaaatctaccatagagtgagaaagcaaactctcattctgcctaatcataataattcactcct---gccattcaaattaattagttgtaca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
9936187 |
atgatgaattcaaatctaccatagagtgagaaagcaaactctcattctgcctaatcataataattcactcctgccgccattcaaattatttagttgtaca |
9936088 |
T |
 |
| Q |
121 |
tacatattacatactact |
138 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9936087 |
tacatattacatactact |
9936070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 167 - 245
Target Start/End: Complemental strand, 9936028 - 9935950
Alignment:
| Q |
167 |
ctcttttaagaaacataacaaaccnnnnnnnnaacatgctagccaactctttcgttatgaaatattctcaccactatct |
245 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
9936028 |
ctcttttaagaaacataacaaaccttttttttaacatgctagccaactctttcgttatcacgtattctcaccattatct |
9935950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University