View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7001_high_7 (Length: 212)
Name: NF7001_high_7
Description: NF7001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7001_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 47885414 - 47885232
Alignment:
| Q |
14 |
atgaattcatcaccagaaaaatacacacaacagattcttgatttgcaagatcaaggtgcaccggttgggggaataggaattcaaggtcacattgatagtc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47885414 |
atgaattcatcaccagaaaaatacacacaacagattcttgatttgcaagatcaaggtgcaccggttgggggaataggaattcaaggtcacattgatagtc |
47885315 |
T |
 |
| Q |
114 |
ctgtggggcctattgtttgtgctgcactcgataagttggctactcttggtcagccaatttggtttaccgagcttgatgtgtct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47885314 |
ctgtggggcctattgtttgtgctgcactcgataagttggctactcttggtcagccaatttggtttaccgagcttgatgtgtct |
47885232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 42 - 196
Target Start/End: Original strand, 4623703 - 4623857
Alignment:
| Q |
42 |
aacagattcttgatttgcaagatcaaggtgcaccggttgggggaataggaattcaaggtcacattgatagtcctgtggggcctattgtttgtgctgcact |
141 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| ||||| ||||| ||||||||||| ||||| |||||||| || |||||| |||||||| || |||| |
|
|
| T |
4623703 |
aacacattcttgatttgcaagaacaaggtgcacctgttggtggaattggaattcaaggacacatagatagtccagttgggcctgttgtttgttcttcact |
4623802 |
T |
 |
| Q |
142 |
cgataagttggctactcttggtcagccaatttggtttaccgagcttgatgtgtct |
196 |
Q |
| |
|
||||| || | || ||||||| || || |||||||| || |||||||||||| |
|
|
| T |
4623803 |
tgataaattaggtattcttggtttaccgatatggtttacagaacttgatgtgtct |
4623857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University