View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7001_low_11 (Length: 220)
Name: NF7001_low_11
Description: NF7001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7001_low_11 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 34499682 - 34499901
Alignment:
| Q |
1 |
ttgcgagaccaaatccaaagagatggctgagacatcttctgtgcgtgatacggaggtctggagcagaatctggaaattcaacggccctagaagcgcgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34499682 |
ttgcgagaccaaatccaaagagatggctgagacatctactgtgcgtgatacggaggtctggagcagaatctagaaattcaacggccctagaagcgcgcaa |
34499781 |
T |
|
| Q |
101 |
aacttcctttggaggctaggaagcaatattcttcctaccagatgtaatctcagtaaaaaaggtatttctctggacactacttgccccctctgtaattctg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34499782 |
aacttcctttggaggctagcaagcaatattcttcctaccagatgtaatctcagtaaaaaaggtatttctctggacactacttgccccctctgtaattctg |
34499881 |
T |
|
| Q |
201 |
gtgttgaagataggaaccat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34499882 |
gtgttgaagataggaaccat |
34499901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 71 - 175
Target Start/End: Complemental strand, 8367925 - 8367821
Alignment:
| Q |
71 |
tggaaattcaacggccctagaagcgcgcaaaacttcctttggaggctaggaagcaatattcttcctaccagatgtaatctcagtaaaaaaggtatttctc |
170 |
Q |
| |
|
||||| ||||| || || || ||||| ||||| ||||||||| |||| | ||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8367925 |
tggaatttcaatggtcccaggagcgcccaaaatttcctttggcggcttgctagcaacattctccctaccagatgtaatctcagtaaaaaaggtatatctc |
8367826 |
T |
|
| Q |
171 |
tggac |
175 |
Q |
| |
|
||||| |
|
|
| T |
8367825 |
tggac |
8367821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 175
Target Start/End: Complemental strand, 199419 - 199315
Alignment:
| Q |
71 |
tggaaattcaacggccctagaagcgcgcaaaacttcctttggaggctaggaagcaatattcttcctaccagatgtaatctcagtaaaaaaggtatttctc |
170 |
Q |
| |
|
||||| ||||| || || || |||| |||||| ||||||||| |||| | ||||| | ||| |||||||||||||||||||| ||||| ||||| ||| |
|
|
| T |
199419 |
tggaatttcaatggtcccaggagcgtgcaaaatttcctttggcggcttgctagcaacagtctccctaccagatgtaatctcagcaaaaatggtataactc |
199320 |
T |
|
| Q |
171 |
tggac |
175 |
Q |
| |
|
||||| |
|
|
| T |
199319 |
tggac |
199315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University