View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7001_low_5 (Length: 291)
Name: NF7001_low_5
Description: NF7001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7001_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 34500084 - 34500360
Alignment:
| Q |
1 |
tttcaaaaacactccttttgattcggtccaaattgcgcaatctgcagtgttgttggttaatgagtttaacttggcaaacaggaaagtggaatgtcaccgc |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34500084 |
tttcaaaaacactccttttgatccggtccaaattgcgcagtctgcagtgttgttggttgatgagtttaacttggcaaacaggaaagtggaatgtcagcgc |
34500183 |
T |
|
| Q |
101 |
gtaacccctgcaccctctcggtggtgtcctcctccggatggaactatcaagattaatgtcgacgtagggtgcttcaaagatggcagcatggggtggggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500184 |
gtaacccctgcaccctctcggtggtgtcctcctccggatggaactatcaagattaatgtcgacgcagggtgcttcaaagatggcagcatggggtggggtt |
34500283 |
T |
|
| Q |
201 |
ttgctgttagaaaccatcagggaggggtgttgttctctgcttctcgtaaggatcttgatgttgtgtcaccgttgatg |
277 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| | |||||||| ||||||| |||||||||||||||| |
|
|
| T |
34500284 |
ttgctgctagaaaccatcagggaggggtgttgttctctgctacccgtaaggaacttgatgctgtgtcaccgttgatg |
34500360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University