View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7001_low_6 (Length: 274)
Name: NF7001_low_6
Description: NF7001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7001_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 24 - 242
Target Start/End: Original strand, 22704293 - 22704511
Alignment:
| Q |
24 |
agaacgcagcaggaattggttacctcagttagatatccccgttttggaattggttaccgatgatgtgaaccctcttgaagtggagagaacgcagcaggaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22704293 |
agaacgcagcaggaattggttacctcagttagatatccccgttttggaattggttaccgatgatgtgaaccctcttgaagtggagagaacgcagcaggaa |
22704392 |
T |
 |
| Q |
124 |
tctcgatacgacagtgttccaatgcttcatggaattatgtagagcacgttgacgtgtatgagaattttgaaggagctaccttggatttggttagggaggt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22704393 |
tctcgatacgacagtgttccaatgcttcatggaattatgtagagcacgttgacgtgtatgagaattttgaaggagctaccttggatttggttagggaggt |
22704492 |
T |
 |
| Q |
224 |
caacaattcacaggttctg |
242 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
22704493 |
caacaattcactggttctg |
22704511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 20737341 - 20737276
Alignment:
| Q |
158 |
ttatgtagagcacgttgacgtgtatgagaattttgaaggagctaccttggatttggttagggaggt |
223 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||| || ||||||||||||| | |||||||||| |
|
|
| T |
20737341 |
ttatgtagagcatgttgacgtgcatgagaattttgatggcgctaccttggattcgattagggaggt |
20737276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 33957273 - 33957208
Alignment:
| Q |
158 |
ttatgtagagcacgttgacgtgtatgagaattttgaaggagctaccttggatttggttagggaggt |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
33957273 |
ttatgtagagcacgttgacgtgcatgagaattttgatggtgctaccttggattcggttagggaggt |
33957208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 81 - 126
Target Start/End: Complemental strand, 33957369 - 33957324
Alignment:
| Q |
81 |
cgatgatgtgaaccctcttgaagtggagagaacgcagcaggaatct |
126 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
33957369 |
cgatgacgtggaccctcttgaagtagagagaacgcatcaggaatct |
33957324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 2040959 - 2040894
Alignment:
| Q |
158 |
ttatgtagagcacgttgacgtgtatgagaattttgaaggagctaccttggatttggttagggaggt |
223 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
2040959 |
ttatgtagagcacgtagacgtgcatgagaattttgatggtgctaccttggattcggttagggaggt |
2040894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 32238575 - 32238510
Alignment:
| Q |
158 |
ttatgtagagcacgttgacgtgtatgagaattttgaaggagctaccttggatttggttagggaggt |
223 |
Q |
| |
|
|||||||||| | ||||||||| ||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
32238575 |
ttatgtagagaatgttgacgtgcatgagaattttgatggcgctaccttggattcggttagggaggt |
32238510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 32238741 - 32238677
Alignment:
| Q |
159 |
tatgtagagcacgttgacgtgtatgagaattttgaaggagctaccttggatttggttagggaggt |
223 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
32238741 |
tatgtagagcatgttgacgtgcatgagaattttgatggcattaccttggattcagttagggaggt |
32238677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University