View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7001_low_8 (Length: 247)
Name: NF7001_low_8
Description: NF7001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7001_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 34531148 - 34531383
Alignment:
| Q |
1 |
agacatagaatgttttttacatcttttatattgacgatttagatttgcactggtcaaagaaaatagtgtgcttatactttatggataattgagggtaaat |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34531148 |
agacatagaatgtattttacatcttttatattgacgatttagatttgcactggtcaaagaaaatagtgtgcttatactttatggataattgagggtaaat |
34531247 |
T |
 |
| Q |
101 |
aatctggtttttcatttctttctaattgnnnnnnngacaaaagaagatccaaagcaaactatgtagttgactttcatcaaatatttgctttgtagaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34531248 |
aatctggtttttcatttctttctaattgtttttttgacaaaagaagatccaaagcaaactatgtagttgactttcatcaaatatttgctttgtagaacca |
34531347 |
T |
 |
| Q |
201 |
gagagtcaattacttgctactgtagtgatgtccatc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34531348 |
gagagtcaattacttgctactgtagtgatgtccatc |
34531383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University