View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7002_high_13 (Length: 268)
Name: NF7002_high_13
Description: NF7002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7002_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 40329338 - 40329592
Alignment:
| Q |
1 |
ttgatagaatcaaaaaggagaatgatagcatgcaaattgatctcaggtattatacaaacatttttatttatatgtattgccctagctagctataatcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40329338 |
ttgatagaatcaaaaaggagaatgatagcatgcaaattgatctcaggtattatacaaacatttttatttatatgtattgccctagctagctataatcaaa |
40329437 |
T |
 |
| Q |
101 |
atttataaatatcattgatcaagggtacatatatatgttaatttcaggcacttgaagggagaggatattacctcactgaattacaaagagctgatggccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40329438 |
atttataaatatcattgatcaagggtacatatatatgttaatttcaggcacttgaagggagaggatattacctcactgaattacaaagagctgatggccc |
40329537 |
T |
 |
| Q |
201 |
ttgaggaatcccttgaaaatggtcttactggcgtccgtgacaaaaaggtaattaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40329538 |
ttgaggaatcccttgaaaatggtcttactggcgtccgtgacaaaaaggtaattaa |
40329592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University