View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7002_low_16 (Length: 258)
Name: NF7002_low_16
Description: NF7002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7002_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 2265410 - 2265172
Alignment:
| Q |
10 |
aacctgtgaaggaaaaaggtgtgtttgatatactaaaa-gtaaatacgggacacaataatatcatacaaaacaacatatgacaaacctttaaagtattga |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265410 |
aacccgtgaaggaaaaaggtgtgtttgatatactaaaaagtaaatacggaacacaataatatcatacaaaacaacatatgacaaacctttaaagtattga |
2265311 |
T |
 |
| Q |
109 |
gcaactttttatgttgtatgatctatgtttggtggacaaaatattattttgacattttagagacatgttattttgtcatataagctttatgaaaagattg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265310 |
gcaactttttatgttgtatgatctatgtttggtggacaaaatattattttgacattttagagacatgttattttgtcatataagctttatgaaaagattg |
2265211 |
T |
 |
| Q |
209 |
atttatagaaactatacaatgcaacaggtggaatttgat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265210 |
atttatagaaactatacaatgcaacaggtggaatttgat |
2265172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University