View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7003_high_23 (Length: 257)
Name: NF7003_high_23
Description: NF7003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7003_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 37160335 - 37160111
Alignment:
| Q |
15 |
tgctcttatgtgtgttattgggatttaagatacttgtacttatagatcatgtattacaatgagcggagccttgatgcaacggtaaattgttactggatag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160335 |
tgctcttatgtgtgttattgggatttaagatacttgtacttatagatcatgtattacaatgagcggagccttgatgcaacggtaaattgttactggatag |
37160236 |
T |
 |
| Q |
115 |
gtcctttgttgtgatttataataatagcacaattgtgggctgatactgttgcaaactctgccgcaacaataatattgcagccccatggggtccagaaatt |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160235 |
gtcctttgttgtgatttataatcatagcacaattgtgggctgatactgttgcaaactctgccgcaacaataatattgcagccccatggggtccagaaatt |
37160136 |
T |
 |
| Q |
215 |
aaaactgctaaaaatatactgatct |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37160135 |
aaaactgctaaaaatatactgatct |
37160111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 119 - 196
Target Start/End: Complemental strand, 43394335 - 43394258
Alignment:
| Q |
119 |
tttgttgtgatttataataatagcacaattgtgggctgatactgttgcaaactctgccgcaacaataatattgcagcc |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| |||| |||||| || || | || |||||||||||||||| |
|
|
| T |
43394335 |
tttgttgtgatttataatcatagcacaattgcgggttgatgtcgttgcagacactactacagcaataatattgcagcc |
43394258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University