View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7003_low_24 (Length: 257)

Name: NF7003_low_24
Description: NF7003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7003_low_24
NF7003_low_24
[»] chr5 (1 HSPs)
chr5 (15-239)||(37160111-37160335)
[»] chr2 (1 HSPs)
chr2 (119-196)||(43394258-43394335)


Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 37160335 - 37160111
Alignment:
15 tgctcttatgtgtgttattgggatttaagatacttgtacttatagatcatgtattacaatgagcggagccttgatgcaacggtaaattgttactggatag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37160335 tgctcttatgtgtgttattgggatttaagatacttgtacttatagatcatgtattacaatgagcggagccttgatgcaacggtaaattgttactggatag 37160236  T
115 gtcctttgttgtgatttataataatagcacaattgtgggctgatactgttgcaaactctgccgcaacaataatattgcagccccatggggtccagaaatt 214  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37160235 gtcctttgttgtgatttataatcatagcacaattgtgggctgatactgttgcaaactctgccgcaacaataatattgcagccccatggggtccagaaatt 37160136  T
215 aaaactgctaaaaatatactgatct 239  Q
    |||||||||||||||||||||||||    
37160135 aaaactgctaaaaatatactgatct 37160111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 119 - 196
Target Start/End: Complemental strand, 43394335 - 43394258
Alignment:
119 tttgttgtgatttataataatagcacaattgtgggctgatactgttgcaaactctgccgcaacaataatattgcagcc 196  Q
    |||||||||||||||||| |||||||||||| ||| ||||   |||||| || || |  || ||||||||||||||||    
43394335 tttgttgtgatttataatcatagcacaattgcgggttgatgtcgttgcagacactactacagcaataatattgcagcc 43394258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University