View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7003_low_29 (Length: 241)
Name: NF7003_low_29
Description: NF7003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7003_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 11248581 - 11248811
Alignment:
| Q |
1 |
ccaaattaagcaaggaaccaatcaaaccaaactaacacataaagagaacaaaaacaaaacatgttttccccaagcaaccgtaaatcttcaactttt---- |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11248581 |
ccaaattaagcaaggaaccaatcaaaccaaactaacacataaagagaacaaaaacaaaacatgttttccccaagcaactgtaaatcttcaacttttcaat |
11248680 |
T |
|
| Q |
97 |
--------actttcattcaaattttcatctttttccaattaggtccaacctggaattctcttagtc-aaattttcttgttttaattgattgtcattcttt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||| | |
|
|
| T |
11248681 |
ttcactttactttcattcaaattttcatctttttccaattaggtccaacctggaattctcttagtcaaaatcttcttgttttaattgattgccattctat |
11248780 |
T |
|
| Q |
188 |
gtttgatgacgacttgaatcattatgaccca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11248781 |
atttgatgacgacttgaatcattatgaccca |
11248811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University