View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7003_low_35 (Length: 213)
Name: NF7003_low_35
Description: NF7003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7003_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 19387131 - 19387331
Alignment:
| Q |
1 |
ctattgtcttcatcagcagacaactgtgcatcacgtcttgagagcctgctttcaataagtccagcttctgccaagcctggaaaacaatattcttcagata |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19387131 |
ctattgtcttcaatagcagacaactgtgcatcacgtcttgagagcctgctttcaataagtccagcttctgccaagcctggaaaacaatattcttcagata |
19387230 |
T |
|
| Q |
101 |
acataatggcatagaccaagtggttatattgctaaaaatgataatcatgtcaagttctgaccttgaatggaagaaaaatcagggtcctcaggggtgatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19387231 |
acataatggcatagaccaagtggttgtattgctaaaaatgataatcatgtcaagttctgaccttgaatggaagaaaaatcagggtcctcaggggtgatgt |
19387330 |
T |
|
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
19387331 |
c |
19387331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University