View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7005_low_1 (Length: 312)
Name: NF7005_low_1
Description: NF7005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7005_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 40 - 288
Target Start/End: Complemental strand, 40350208 - 40349964
Alignment:
| Q |
40 |
tgttatatttaattacagtgtgtttagatgaataagagggtactaaacannnnnnnngtggaattatttgcagggtttgtatcacaggaactaggaatgc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40350208 |
tgttatatttaattacagtgtgtttagatgaatacgagggtgctaaaaatttt----gtggaattatttgcagggtttgtatcacaggaactaggaatgc |
40350113 |
T |
|
| Q |
140 |
tgaacgtggattagatgcatcaaataagacagggcctatgagcatctttgtttaagatgtgttgcattgcatttcagttattattattgttatgtgattt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40350112 |
tgaacgtggattagatgcatcaaataagacagggcctatgagcatctttgtttaagatgtgttgcattgcatttcagttattataattgttatgtgattt |
40350013 |
T |
|
| Q |
240 |
caaaagttgaaggatatataatcttgttaaagagaccttcaaattgaat |
288 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40350012 |
cagaagttgaaggatatataatcttgttaaagagaccttcaaattgaat |
40349964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University