View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7006_high_11 (Length: 205)
Name: NF7006_high_11
Description: NF7006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7006_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 18645519 - 18645349
Alignment:
| Q |
19 |
actgaaacaggactttttccaggaagtcttaccgaggtagattttttattttgtcaccataattgcgggcgcgattgataccaatgtgccagcaataaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18645519 |
actgaaacaggactttttccaggaagtcttaccgaggtagattgtttattttgtcaccataattgcgggcgcgattgataccaatgtgccaccaataaca |
18645420 |
T |
|
| Q |
119 |
caactgaaacacgctccttgattttgtagcaaatgtggccaatgcggaagcaatttctgttgtcatttcat |
189 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645419 |
cgactgaaaaacgctccttgattttgtagcaaatgtggccaatgcggaagcaatttctgttgtcatttcat |
18645349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University