View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7006_high_8 (Length: 236)
Name: NF7006_high_8
Description: NF7006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7006_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 93 - 219
Target Start/End: Original strand, 28588677 - 28588803
Alignment:
| Q |
93 |
agtctaactctttctcaaaaaatccacttgtacagtgagagtgtctctcacttataaaatcttagataaactttgatactatcctagcgtgtgtgttcga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28588677 |
agtctaactctttctcaaaaaatccacttgtacagtgagagtgtctctcacttataaaatcttagataaactttgatactatcctagcgtgtgtattcga |
28588776 |
T |
 |
| Q |
193 |
atgagtaatgaacttgacaaattcatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28588777 |
atgagtaatgaacttgacaaattcatg |
28588803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 28588513 - 28588604
Alignment:
| Q |
1 |
agaacagttgaggactaatcaaggtttaattttacaaccaagttataataagtgattgatgatgatttaagttcaataatcgcacaagcatg |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28588513 |
agaacagttgaggactaatcaaggtttaattttacaaccaagttataataagtgattgatgatgatttaagttcaataatcccacaagcatg |
28588604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University