View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7007_high_2 (Length: 386)
Name: NF7007_high_2
Description: NF7007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7007_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 93 - 368
Target Start/End: Original strand, 50529771 - 50530052
Alignment:
| Q |
93 |
atcatatcgtgtttgttgtctgtgactgtgcttaatggtgg------atgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529771 |
atcatatcgtgtttgttgtctgtgactgtgcttagtggtggatgtggatgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
50529870 |
T |
 |
| Q |
187 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacccttccggaaaagaaggaacggtgatcctccatttagcagaagagacaccgactgtgg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529871 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacccttccggaaaagaaggaacggtgatcctccatttagcagaagagacaccgactgtgg |
50529970 |
T |
 |
| Q |
287 |
tgccgacgtacttggtgaaacctctggcaactgcagcatttgacatcacgtaatccatgatgagatttgcaccggttataaa |
368 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529971 |
tgccgacgtacttggtgaaacctctagcaactgcagcatttgacatcacgtaatccatgatgagatttgcaccggttataaa |
50530052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 14 - 63
Target Start/End: Original strand, 50529702 - 50529751
Alignment:
| Q |
14 |
cacacacgtgaacacgaacacattcaatttactcattttctcaaattacc |
63 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50529702 |
cacacacgtgaacacgaacacattcaattaactcattttctcaaattacc |
50529751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University