View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7007_low_9 (Length: 271)
Name: NF7007_low_9
Description: NF7007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7007_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 35 - 262
Target Start/End: Complemental strand, 40390194 - 40389977
Alignment:
| Q |
35 |
atatgctctttcaaactatagaaaacttctatttcttggcattctctcattgttatttctctttttctatatctacccagtatcatgctataaaaagtag |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40390194 |
atatgctctttcaaactatagaaaacttctatttcttggtattctctcattgttatttctctttttctatatctacccaacatcatgctataaaa----- |
40390100 |
T |
 |
| Q |
135 |
ctcttaattaataactgtcttggctttaggatacgttcaatcctctnnnnnnnngcatgctggtatgcatttgtgcaatctttgccaaatcctgagcctt |
234 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40390099 |
-----aagtaataactgtcttggctttaggatacgttcaatcctctaaaaaaaagcatgccggtatgcatttgtgcaatctttgccaaatcctgagcctt |
40390005 |
T |
 |
| Q |
235 |
gggcttttaaagctttccctgtctatgc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40390004 |
gggcttttaaagctttccctgtctatgc |
40389977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University