View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7009_high_10 (Length: 356)
Name: NF7009_high_10
Description: NF7009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7009_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 8700002 - 8699769
Alignment:
| Q |
1 |
attatggattaactttgtaagcggttcaggcagcacctgaaattttattgcagtttttacttgatnnnnnnnnnngttttaaataagtattttctattct |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8700002 |
attatggattaagtttgtaagcggttcaagcagctcttgaaattttattgcagtttttacttgataaaaaaaaaagttttaaataagtattttctattct |
8699903 |
T |
|
| Q |
101 |
atcctagaatacttaatgagatggtgaggaatctcctacaagtcttgatttcaaatctagaagagttttgtgattcattgtgatgccttacccgacttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8699902 |
atcctagaatacttaatgagatggtgaggaatctcctagaggtcttgatttcaaatctagaagagttttgtaattcattgtgatgccttacccgatttaa |
8699803 |
T |
|
| Q |
201 |
ggaattagtctatacactttgcacaaagataccc |
234 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| |
|
|
| T |
8699802 |
ggaattagtttatacactttgcacagagataccc |
8699769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 125
Target Start/End: Original strand, 14382892 - 14382932
Alignment:
| Q |
85 |
aagtattttctattctatcctagaatacttaatgagatggt |
125 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
14382892 |
aagtattttctattctatcctaaaatacttaaagagatggt |
14382932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 52773591 - 52773527
Alignment:
| Q |
1 |
attatggattaactttgtaagcggttcaggcagcacctgaaattttattgcagtttttacttgat |
65 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52773591 |
attacggactaactttgtaagcggttgaggcagctcctgaaattttattgcagtttttacttgat |
52773527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University