View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7009_low_13 (Length: 303)
Name: NF7009_low_13
Description: NF7009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7009_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 10779450 - 10779538
Alignment:
| Q |
1 |
tctctttgacgcacaactgaaactataactaacccatagtagataatgtcatttcaattatacttttataacccgtagtaaataatgtc |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10779450 |
tctctttgacgcacaactgaaactataactaacccatagtagataatgtcattttaattatacttttataacccgtagtaaataatgtc |
10779538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 226 - 291
Target Start/End: Original strand, 10779675 - 10779739
Alignment:
| Q |
226 |
aggaatattgtttgaaatcactattaggcgtaactaaccataacaagttaaataattcatctcact |
291 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10779675 |
aggaatattgtttgaa-tcactattaggcgtaactaaccataacaagttaaataattcatctcact |
10779739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University