View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7009_low_18 (Length: 277)

Name: NF7009_low_18
Description: NF7009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7009_low_18
NF7009_low_18
[»] chr4 (1 HSPs)
chr4 (9-245)||(7155484-7155691)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 7155691 - 7155484
Alignment:
9 tttggtggtactagatgaaccctttaaaatttaagtattgttttttgttttggatttaatgaacccataagttatttacttttagcctcaaattttagac 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||                 |||||||||||||||||||||||||||        
7155691 tttggtggtactagatgaaccctttaaaatttaagtattgttttttgttatg-----------------agttatttacttttagcctcaaatttt---- 7155613  T
109 ttaatttttaactaatttacttgcagtaagaaatttattgctttcacgaatatagggcaattgtagtcattgattcaagacctgagaaaaatacgaattt 208  Q
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7155612 --------taactaatttacttgcagtaagaaatttattgctttcacgaatatagggcaattgtagtcattgattcaagacctgagaaaaatacgaattt 7155521  T
209 tgtagtcattgataggaaggtccatatttagggaaaa 245  Q
    ||||||||||||| |||||||||||||||||||||||    
7155520 tgtagtcattgattggaaggtccatatttagggaaaa 7155484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University