View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7009_low_18 (Length: 277)
Name: NF7009_low_18
Description: NF7009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7009_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 7155691 - 7155484
Alignment:
| Q |
9 |
tttggtggtactagatgaaccctttaaaatttaagtattgttttttgttttggatttaatgaacccataagttatttacttttagcctcaaattttagac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
7155691 |
tttggtggtactagatgaaccctttaaaatttaagtattgttttttgttatg-----------------agttatttacttttagcctcaaatttt---- |
7155613 |
T |
|
| Q |
109 |
ttaatttttaactaatttacttgcagtaagaaatttattgctttcacgaatatagggcaattgtagtcattgattcaagacctgagaaaaatacgaattt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7155612 |
--------taactaatttacttgcagtaagaaatttattgctttcacgaatatagggcaattgtagtcattgattcaagacctgagaaaaatacgaattt |
7155521 |
T |
|
| Q |
209 |
tgtagtcattgataggaaggtccatatttagggaaaa |
245 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7155520 |
tgtagtcattgattggaaggtccatatttagggaaaa |
7155484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University