View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7009_low_22 (Length: 236)
Name: NF7009_low_22
Description: NF7009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7009_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 47 - 222
Target Start/End: Complemental strand, 10779383 - 10779208
Alignment:
| Q |
47 |
ctttcaagggtcactctcgaatctcttatgcttcttaaattttttcacatcgcgtggtcgacattagaggaagctccaaactaatgggattatgcttgga |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
10779383 |
ctttcaagggtcactctcgaatctcttatgcttcttaaatttttttatatcgcgaggtcgacattagaggaatctccaaactaatggaattatgcttgga |
10779284 |
T |
 |
| Q |
147 |
tactttaaccaggcagatggctagaatgtatcgcgtgaccgacattagaggaagctccaagctaagatattctctc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
10779283 |
tactttaaccaggcagatggctagaatgtatcgcgtgaccgacattagaggaagcttcaaactaagatgttctctc |
10779208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University