View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7010_low_5 (Length: 243)
Name: NF7010_low_5
Description: NF7010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7010_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 32 - 220
Target Start/End: Original strand, 44829481 - 44829669
Alignment:
| Q |
32 |
ttattgtcgatgcatcagtattatcccagatatgaaattggccacaaccacaagaaacaaaataggttggataggtgataaaagtattgccacacgcaac |
131 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829481 |
ttattgtcgatgcatcaatattatcccagatatgaaattggccacaaccacaagaaacaaaataggttggataggtgataaaagtattgccacacgcaac |
44829580 |
T |
|
| Q |
132 |
actctcccttttgaagtagtagcaaggtagtaggctcccgcaaaaaaggaatatcttgtcaatatggaacaaatcaacatgaactatat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829581 |
actctcccttttgaagtagtagcaaggtagtaggctcccgcaaaaaaggaatatcttgtcaatatggaacaaatcaacatgaactatat |
44829669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University