View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7011_high_6 (Length: 299)
Name: NF7011_high_6
Description: NF7011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7011_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 265
Target Start/End: Complemental strand, 45655917 - 45655672
Alignment:
| Q |
20 |
cagggtctgaagatacatcttctgagttgagcgtcaatgaggcagaagccaacaaaactgattgatattattgatgttgtatgcccttgcttcaaacatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45655917 |
cagggtctgaagatacatcttctgagttgagcgtcaatgaggcagaagccgacaaaactgattgatattattgatgttgtatgcccttgcttcaaacatt |
45655818 |
T |
 |
| Q |
120 |
ttgaatgttttctcattctaaccaataatgcaaagttttttattggtttaaatgatgtgtttttacaggtagtttgtctctttgtgaacttgaggctgaa |
219 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45655817 |
ttgattgttttctcattctaaccaataattcaaagttttttattggtttaaatgatgtgtttttacaggtagtttgtctctttgtgaacttgaggctgaa |
45655718 |
T |
 |
| Q |
220 |
cagataaaagaaattgatagttgtaagcacaagcatctctgtgatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45655717 |
cagataaaagaaattgatagttgtaagcacaagcatctctgtgatt |
45655672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University