View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7011_low_14 (Length: 248)
Name: NF7011_low_14
Description: NF7011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7011_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 56 - 243
Target Start/End: Complemental strand, 44715320 - 44715136
Alignment:
| Q |
56 |
taatcattggtttatttgctatatataaattatattaactacnnnnnnnatatataaataatgttcataagtccacagttactcgtgcataggatagcat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
44715320 |
taatcattggtttatttgctatatataaattatattaactacttttt---tttataaataatgttcataagtccacggttactcctgcataggatagcat |
44715224 |
T |
 |
| Q |
156 |
ggtatgcacgagaccctacattcgtaattatattatttcaactaaaaacattgtatatgttgtattattagagaatgattatagtata |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715223 |
ggtatgcacgagaccctacattcgtaattatattatttcaactaaaaacattgtatatgttgtattattagagaatgattatagtata |
44715136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University