View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7011_low_7 (Length: 309)
Name: NF7011_low_7
Description: NF7011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7011_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 9e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 224 - 295
Target Start/End: Complemental strand, 8064176 - 8064105
Alignment:
| Q |
224 |
aatacttcacaatgtggatccaattaactacaaattgaagaatattttcatgtgacttagtattcaacgata |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8064176 |
aatacttcacaatgtggatccaattaactacaaattgaagaatattttcatgtgacttagtattcaacgata |
8064105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University