View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7012_low_11 (Length: 212)
Name: NF7012_low_11
Description: NF7012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7012_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 26 - 191
Target Start/End: Original strand, 40349962 - 40350127
Alignment:
| Q |
26 |
tgattcaatttgaaggtctctttaacaagattatatatccttcaacttttgaaatcacataacaataataataactgaaatgcaatgcaacacatcttaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40349962 |
tgattcaatttgaaggtctctttaacaagattatatatccttcaacttctgaaatcacataacaattataataactgaaatgcaatgcaacacatcttaa |
40350061 |
T |
|
| Q |
126 |
acaaagatgctcataggccctgtcttatttgatgcatctaatccacgttcagcattcctagttcct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40350062 |
acaaagatgctcataggccctgtcttatttgatgcatctaatccacgttcagcattcctagttcct |
40350127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University