View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7012_low_6 (Length: 297)
Name: NF7012_low_6
Description: NF7012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7012_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 26 - 276
Target Start/End: Original strand, 40349962 - 40350208
Alignment:
| Q |
26 |
tgattcaatttgaaggtctctttaacaagattatatatccttcaacttttgaaatcacataacaataataataactgaaatgcaatgcaacacatcttaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40349962 |
tgattcaatttgaaggtctctttaacaagattatatatccttcaacttctgaaatcacataacaattataataactgaaatgcaatgcaacacatcttaa |
40350061 |
T |
|
| Q |
126 |
acaaagatgctcataggccctgtcttatttgatgcatctaatccacgttcagcattcctagttcctgtgatacaaaccctgcaaataattccacnnnnnn |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40350062 |
acaaagatgctcataggccctgtcttatttgatgcatctaatccacgttcagcattcctagttcctgtgatacaaaccctgcaaataattccac----aa |
40350157 |
T |
|
| Q |
226 |
nntgtttagtaccctcttattcatctaaacacactgtaattaaatataaca |
276 |
Q |
| |
|
| ||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40350158 |
aatttttagcaccctcgtattcatctaaacacactgtaattaaatataaca |
40350208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University