View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7012_low_8 (Length: 251)
Name: NF7012_low_8
Description: NF7012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7012_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 5 - 205
Target Start/End: Original strand, 45767481 - 45767682
Alignment:
| Q |
5 |
atacaatgattgtagaatccactatatataacttctcactgatcataactaacttagcaatcataaacaatattgaattaattctaattattatccaact |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
45767481 |
atacaatgattgtagaatacactatatataacttctcactgatcataactaacttagcaatcattaacaatattgtattaattctaattattatccaact |
45767580 |
T |
|
| Q |
105 |
atatctat-caagcatacaagcatggatctcaaacaacaaattattactttggtccatcatgaataatatatttccatataaagtgaaaaacaataattt |
203 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
45767581 |
atatctatccaagcatacaagcatggatctcaaacaacaaattattactttggtccatcatgaataatatatttacatataaagtgaaaagaaataattt |
45767680 |
T |
|
| Q |
204 |
ta |
205 |
Q |
| |
|
|| |
|
|
| T |
45767681 |
ta |
45767682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University