View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7013_high_3 (Length: 247)
Name: NF7013_high_3
Description: NF7013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7013_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 236
Target Start/End: Complemental strand, 16343225 - 16343001
Alignment:
| Q |
11 |
actgtccaaaagtcgtaaaaacaatttaaattttgaaaccgttcttcaatactttgactatgttttttatgtcaatcacgaaggcaacaccttattcttt |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16343225 |
actgtccagaagtcgtaaaaacaatttaaattttgataccgttcttcaatactttgactatgttttttgtgtcaatcacgaaggcaacaccttattcttt |
16343126 |
T |
 |
| Q |
111 |
taannnnnnnnccttcaacgcaaaacaaccttcacccaaaacttgacaatcattttatatgtcttttaccaattcttgattacccagcaaaatcg-cccc |
209 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
16343125 |
taattttttt-ccttcaacgcaaaacaaccttcactcaaaacttgacaatcattttatatgtcttttaccaattcttga-tacccagcaaaatcgccccc |
16343028 |
T |
 |
| Q |
210 |
aacactcaaccgtcctaaaatgatgtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
16343027 |
aacactcaaccgtcctaaaatgatgtc |
16343001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University