View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7013_low_2 (Length: 270)
Name: NF7013_low_2
Description: NF7013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7013_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 5e-31; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 177 - 261
Target Start/End: Complemental strand, 31658233 - 31658150
Alignment:
| Q |
177 |
tgtgtgttttcttcttttcattcctcattcatattgtttaattttgttcaagattattattgcatttcttttagtttttgatgtc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||| |
|
|
| T |
31658233 |
tgtgtgttttcttcttttcattcctcattcatattgtttaattttgttcaagattattattgcattt-ttttggtttttgttgtc |
31658150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 31658403 - 31658355
Alignment:
| Q |
127 |
tgattattttgatgaatgaaacttcttgattttcttagtagtatttata |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658403 |
tgattattttgatgaatgaaacttcttgattttcttagtagtatttata |
31658355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 95 - 128
Target Start/End: Complemental strand, 31658263 - 31658230
Alignment:
| Q |
95 |
tcaaagtaagtcattattggacaaatattgtgtg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31658263 |
tcaaagtaagtcattattggacaaatattgtgtg |
31658230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 81
Target Start/End: Complemental strand, 31658339 - 31658304
Alignment:
| Q |
46 |
ctaattcttgtaattgcttttcgaatttttgtgtaa |
81 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31658339 |
ctaattcttgtaattgctttttgaatttttgtgtaa |
31658304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 248
Target Start/End: Original strand, 7325125 - 7325193
Alignment:
| Q |
183 |
ttttcttcttttcattcctcattcatattgtt---taattttgttcaagattattattgcatttctttt |
248 |
Q |
| |
|
|||||||||| || |||||| ||||||||||| || ||||||||||||||||||||||||| ||||| |
|
|
| T |
7325125 |
ttttcttcttctccttcctccttcatattgttgtttacttttgttcaagattattattgcattcctttt |
7325193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 254
Target Start/End: Complemental strand, 21334734 - 21334660
Alignment:
| Q |
183 |
ttttcttcttttcattcctcattcatattg---tttaattttgttcaagattattattgcatttcttttagtttt |
254 |
Q |
| |
|
|||||||||| || |||||| ||| ||||| |||| ||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
21334734 |
ttttcttcttctccttcctccttcgtattgctgtttacttttgtttaagattattattgcattccttttggtttt |
21334660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University