View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7014_low_3 (Length: 221)
Name: NF7014_low_3
Description: NF7014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7014_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 9 - 217
Target Start/End: Original strand, 1079732 - 1079940
Alignment:
| Q |
9 |
catcatcacaatctggagcagtgtcgtgatccaaaataattttcgatatctgaaaggtggacatcttatccatccacttgtcacttatggaaatgttgta |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1079732 |
catcataacaatctggagcagtgtcgtgatccaaaataattttcaatatctgaaaggtggacttcttatccatccgcttgtcacttttggaaatgttgta |
1079831 |
T |
|
| Q |
109 |
tcatatgactgttcggccataatgaccgtccaacatcaaccaatagccttctaaacaatgtccatctcttttacggtgtaacaacacaaaatcggaaatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1079832 |
tcatatgactgttcggccataatgaccgtccaacatcaaccaatagccttgtaaacattgtccatctcttttacgttgtaacaacacacaatcggaaatg |
1079931 |
T |
|
| Q |
209 |
ggcggtgat |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
1079932 |
ggcggtgat |
1079940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 110
Target Start/End: Complemental strand, 54043334 - 54043241
Alignment:
| Q |
17 |
caatctggagcagtgtcgtgatccaaaataattttcgatatctgaaaggtggacatcttatccatccacttgtcacttatggaaatgttgtatc |
110 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||| ||| | | |||||| |||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
54043334 |
caatctggatcggtgtcgtgatccaaaatccttttcaatagccggaaggtgtacatcttatccatcagcttgtcacttttggaaatgttgtatc |
54043241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University