View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7015_low_2 (Length: 318)
Name: NF7015_low_2
Description: NF7015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7015_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 20 - 297
Target Start/End: Original strand, 11980365 - 11980642
Alignment:
| Q |
20 |
agttgccgaatggttggattgcgccgtggtgtcatttagggatgacaatgaatgggagtgcagactacagggtcctaaaattgggttgtagaaaatatga |
119 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11980365 |
agttgccgaatggttggattaagcggtggtgtcatttagggatgacaatgaatgggagtgcagactacagggtcctaaaattgggttgtagaaaatatga |
11980464 |
T |
|
| Q |
120 |
aatttacgattcagtaacaaaatgctggagtcatctaggaaagatacctgaatgtattaaggggccaggctgtattatttccacttctatctccattgac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11980465 |
aatttacgattcagtaacaaaatgctggagtcatctaggaaagatacctgaatgtattaaggggccaggctgtattatttccacttctatctccattgac |
11980564 |
T |
|
| Q |
220 |
aacacactttacttcatgcataaacatcaaaagattgtttcctatgacacatcaactagggtttggacacaacacttg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11980565 |
aacacactttacttcatgcataaacatcaaaacattgtttcctatgacacatcaactggggtttggacacaacacttg |
11980642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 54 - 180
Target Start/End: Original strand, 11954261 - 11954390
Alignment:
| Q |
54 |
tttagggatgacaatgaatgggagtgcagactacagggtcctaaaattgggttg---tagaaaatatgaaatttacgattcagtaacaaaatgctggagt |
150 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||| |||||||||||||| || ||||| || |||||||||||||||| |||| || || ||||| |
|
|
| T |
11954261 |
tttagggatgacaatgaatgtgagtgcaggctacagagtcctaaaattgggatgtgatagaacatttgaaatttacgattcaataacgaagtgttggagc |
11954360 |
T |
|
| Q |
151 |
catctaggaaagatacctgaatgtattaag |
180 |
Q |
| |
|
|||||| |||||||||| |||||||||| |
|
|
| T |
11954361 |
catctaaaaaagatacctatatgtattaag |
11954390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University