View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7015_low_3 (Length: 239)
Name: NF7015_low_3
Description: NF7015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7015_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 52543495 - 52543715
Alignment:
| Q |
1 |
gagagggaaaagggaattggagtggattgagttgggtcggtgatggagtggatgtcaagggaacgagtgtcgaggaagaaaggaccagagtgaggggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52543495 |
gagagggaaaagggaattggagtggattgagttgggtcggtgatggagtggatgtcaagggaacgagtgtcgaggaagaaaggaccagagtgaggggttt |
52543594 |
T |
|
| Q |
101 |
ggagagtgaagagtgcagaagcatgaatggttgaagatgggaaatctaagtagagtgtgagggaaatgtgagtggttggtgggtgagttgagtctgtgta |
200 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52543595 |
ggagagtgaaaagtgctgaagcatgaatggttgaagatgggaaatctaagtagagtgtgagggaaatgtgagtggttggtgggtgagttgaatctgtgta |
52543694 |
T |
|
| Q |
201 |
tgagtgaggatcaacgggtgc |
221 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
52543695 |
tgaatgaggatcaacgggtgc |
52543715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University