View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7016_high_17 (Length: 259)
Name: NF7016_high_17
Description: NF7016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7016_high_17 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 39 - 259
Target Start/End: Complemental strand, 54842847 - 54842627
Alignment:
| Q |
39 |
gaacacgggtttaacttggatgttggttctaggttaaaattattatggctacaaataggcctgacgttcttgacccagcccttcttcgcccgggtcgact |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54842847 |
gaacacgggtttaacttggatgttggttctaggttaaaattattatggctacaaataggcctgacgttcttgacccagcccttcttcgcccgggtcgact |
54842748 |
T |
|
| Q |
139 |
tgatcggaaaattgaaattccattaccaaatgagcagtcaaggatggaaatcctcaaaatccatgctgctggaattgcaaagcatggtgaaattgactat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54842747 |
tgatcggaaaattgaaattccattaccaaatgagcagtcaaggatggaaatcctcaaaatccatgctgctggaattgcaaagcatggtgaaattgactat |
54842648 |
T |
|
| Q |
239 |
gaagcagttgttaagcttgcc |
259 |
Q |
| |
|
||||| |||||||| |||||| |
|
|
| T |
54842647 |
gaagcggttgttaaacttgcc |
54842627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 146 - 258
Target Start/End: Complemental strand, 52564076 - 52563964
Alignment:
| Q |
146 |
aaaattgaaattccattaccaaatgagcagtcaaggatggaaatcctcaaaatccatgctgctggaattgcaaagcatggtgaaattgactatgaagcag |
245 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||| || || |||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
52564076 |
aaaattgaaattccattgccaaatgaacaatcaaggatggaaattcttaagatccatgctgctggaattgctaagcatggtgaaatagactatgaagcag |
52563977 |
T |
|
| Q |
246 |
ttgttaagcttgc |
258 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
52563976 |
ttgtgaagcttgc |
52563964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University