View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7016_high_24 (Length: 240)
Name: NF7016_high_24
Description: NF7016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7016_high_24 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 36 - 240
Target Start/End: Complemental strand, 19092202 - 19091998
Alignment:
| Q |
36 |
atcgatttcgctcttcctccaactagaaagttgaaaataacaatcgtagactcgaaatagaagcacattattatttattcatgtcaaagcaacaacctag |
135 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19092202 |
atcgatgtcgctcttcctccaactagaaagttgaaaataacaatcgtagactcgaaatagaagcacattattatttattcatgtcaaagcaacaacctag |
19092103 |
T |
|
| Q |
136 |
aaccagttgatatagacataattccacaaatttaagtggcttagggctcatggttttcttgtaattccgttgcttcattcataggaaatttgaatggttt |
235 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19092102 |
aaccagttgatattgacacaattccacaaatttaagtggtttagggctcatggttttcttgtaattccgttgcttcattcataggaaatttgaatggttt |
19092003 |
T |
|
| Q |
236 |
acgag |
240 |
Q |
| |
|
||||| |
|
|
| T |
19092002 |
acgag |
19091998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University