View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7016_low_11 (Length: 282)
Name: NF7016_low_11
Description: NF7016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7016_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 24011057 - 24010892
Alignment:
| Q |
7 |
gattaatacaattaaagaactatgaatatggtaaaccaattaaccaaattttatcaaaatnnnnnnnccacacaattaagttgagaatatgaagaagaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
24011057 |
gattaatacaattaaagaactatgaatatggtaaaccaattaaccaaattttatcaaaataaaaaa-ccacacaattaagctgaatatatgaagaagaaa |
24010959 |
T |
|
| Q |
107 |
ataaggtaattttgattcaaaaactgattcactgaagaatttcagaacgcctttttgtaggtttgaa |
173 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
24010958 |
ataaggtaattttgattcaaaaattgattcagtgaagaatttcagaacgcctttttgtagatttgaa |
24010892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University