View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7016_low_12 (Length: 280)
Name: NF7016_low_12
Description: NF7016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7016_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 271
Target Start/End: Original strand, 37281371 - 37281616
Alignment:
| Q |
16 |
agaaattatagtaaaagttaagaattttgtatgtataatgtttgaggattggatttagaaaaacca-gtacatgtttgttatgacggtgggatgaacgtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37281371 |
agaaattatagtaaaagttaagaattttgtatgtataatgtttgaggattggatttagaaaaaccaagtacatgtttg-----------ggatgaacgtt |
37281459 |
T |
 |
| Q |
115 |
gacgtgagatggaagcttgaatatataccaagcctgttgaaaatgtagaaaaaacaacattgggacgtaaaattggaggtataatttattcttgaataat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37281460 |
gacgtgagatggaagcttgaatatataccaagcctgttgaaaatgtagaaaaaacaacatcgggacgtaaaattggaggtataatttattcttgaataat |
37281559 |
T |
 |
| Q |
215 |
ttatatttatcttttcaacttttgatacagtcgtaaaattggcatgttcacaggttc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37281560 |
ttatatttatcttttcaacttttgatacagtcgtaaaattggcatgttcacaagttc |
37281616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University