View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7016_low_20 (Length: 246)
Name: NF7016_low_20
Description: NF7016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7016_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 34419491 - 34419694
Alignment:
| Q |
19 |
gatttatcatgtattagttttagacctatcacctaatttgcacacctttcttctactacttgtttacaggaaacaagaatgggcttttgttgccccatac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34419491 |
gatttatcatgtattagttttagacctatcgcctaatttgcacacctttcttctactgctggtttacaggaaacaagaatgggcttttgttgccccatac |
34419590 |
T |
 |
| Q |
119 |
catcacagaccaaggtgattcctgttacaatgtagttatgtttgtttttatttatagtacatgtttgtctccttccttaaagtataggctgtctagggtt |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||| || |
|
|
| T |
34419591 |
caccacagaccaaggtgattcctgttacaatgttattatgtttgtttttatttgtagtacatgtttgtc----tccttaaagtataggctgtttaggatt |
34419686 |
T |
 |
| Q |
219 |
aatctgta |
226 |
Q |
| |
|
||| |||| |
|
|
| T |
34419687 |
aatttgta |
34419694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 80 - 141
Target Start/End: Original strand, 34422780 - 34422841
Alignment:
| Q |
80 |
gtttacaggaaacaagaatgggcttttgttgccccataccatcacagaccaaggtgattcct |
141 |
Q |
| |
|
|||| ||||||| |||||||||||| | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
34422780 |
gtttgcaggaaataagaatgggcttctattgccccataccaccacagaccaaggtgattcct |
34422841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 141
Target Start/End: Original strand, 24346271 - 24346326
Alignment:
| Q |
86 |
aggaaacaagaatgggcttttgttgccccataccatcacagaccaaggtgattcct |
141 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||| |||||| |||||| |||||| |
|
|
| T |
24346271 |
aggaaacaagaatggccttctcttgccccataccaccacagatcaaggtaattcct |
24346326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University