View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7016_low_26 (Length: 239)
Name: NF7016_low_26
Description: NF7016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7016_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 225
Target Start/End: Original strand, 53934103 - 53934313
Alignment:
| Q |
15 |
ttattttgtaaatataaattgttaattttgactgtttaatcaatgccgtggaggcactggttatcattcccgttgatttaattatgttaaaaacaaaaac |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53934103 |
ttatcttgtaaatataaattgttaattttgactgcttaaccaatgccgtgcaggcaccggttatcattcccgttgatttaattatgttaaaaacaaaaac |
53934202 |
T |
 |
| Q |
115 |
agtctgtgtttatgtttggggcagggagaagtcatgtttgattgaaaatcagagaaatggcgactgatttgagtgcagaaagggataaagtacagaagca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53934203 |
agtctgtgtttatgtttggggcagggagaagtcatgtttgattgaaaatcagagaaatggcgactgatttgagtgcagaaagggataaagtacagaagca |
53934302 |
T |
 |
| Q |
215 |
ggagtagtgac |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
53934303 |
ggagtagtgac |
53934313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University