View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_high_32 (Length: 353)
Name: NF7017_high_32
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 19 - 339
Target Start/End: Complemental strand, 10465410 - 10465090
Alignment:
| Q |
19 |
ttatttactctaaggagccccgtgtaatcaagcaagctagccgtagaatattgtatgatgtgggatgcatttattggtcccggatatgtggacacctcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465410 |
ttatttactctaaggagccccgtgtaatcaagcaagctagccgtagaatattgtatgatgtgggatgcatttattggtcccggatatgtggacacctcgt |
10465311 |
T |
 |
| Q |
119 |
gcttctcacgctgatattttttaagctcattcattaatttgagaacttgccaccaacatggtgaaaatggaatctctaggtgttgttctttctgtctata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10465310 |
gcttctcacgctgatattttttaagctcattcattaatttgagaacttgccaccaacatggtgaaaatggaatctctaggtgtggttctttctgtctata |
10465211 |
T |
 |
| Q |
219 |
catacgggtcactacagcaggaatttcccttttgtggcccccaagtcttaaatattattggttgggaatgtaaagaaatgtagggatagctaggttttgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465210 |
catacgggtcactacagcaggaatttcccttttgtggcccccaagtcttaaatattattggttgggaatgtaaagaaatgtagggatagctaggttttgt |
10465111 |
T |
 |
| Q |
319 |
attaaatttgaggagtattat |
339 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10465110 |
attaaatttgaggagtattat |
10465090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University