View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_high_52 (Length: 272)
Name: NF7017_high_52
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_high_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 64 - 268
Target Start/End: Original strand, 29005689 - 29005893
Alignment:
| Q |
64 |
tatgttgcctgggctggaacttttgtagaaccagcttgttaaagtttttaatttataagaagccacatacatggaccctcctccatctcttgcctgcaaa |
163 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29005689 |
tatgttggctgggctggaacttttgtggaaccagcttgttaaagattttcatttataagaagccacatacatggaccctcctccatatcttgcctgcaaa |
29005788 |
T |
 |
| Q |
164 |
atgcctttaatttcaatttgaaaagtttagttctggacttctattttgaatattggcctaccatttctattttaacctaatcttgctacttttgtctctg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29005789 |
atgcctttaatttcaatttgaaaagtttagttctggacttctattttgaatattggcctaccatttctattttaacctaatattgctacttttgtctctg |
29005888 |
T |
 |
| Q |
264 |
ctact |
268 |
Q |
| |
|
||||| |
|
|
| T |
29005889 |
ctact |
29005893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University