View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7017_high_71 (Length: 236)

Name: NF7017_high_71
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7017_high_71
NF7017_high_71
[»] chr4 (1 HSPs)
chr4 (185-220)||(52996883-52996918)


Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 220
Target Start/End: Complemental strand, 52996918 - 52996883
Alignment:
185 gtagttttatatatcaagtaaattgaaatacaaagt 220  Q
    ||||||||||||||||||||||||||||||||||||    
52996918 gtagttttatatatcaagtaaattgaaatacaaagt 52996883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University