View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_31 (Length: 363)
Name: NF7017_low_31
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 19 - 355
Target Start/End: Complemental strand, 24782010 - 24781674
Alignment:
| Q |
19 |
agatccccaagtgcatttcttcactttctttccttcgtatcatcgacctcgccggaaaccgtttctccggtaatatcccctctgatatcggcaaactccg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24782010 |
agatccccaagtgcatttcttcactttctttccttcgtatcatcgacctcgccggaaaccgtttctccggtaatatcccctctgatatcggcaaactccg |
24781911 |
T |
 |
| Q |
119 |
ccatctcaaccgtcttagcatcgccgacaatgtcatcaccggtggaatcccactgtccataaccaacctgactagtttgactcatcttgacatccgtaat |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||| |||| |||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
24781910 |
ccatctcaaccgtctcagcatcgccgacaacgtcatcaccggtggaatccccaggtccttaaccaacctaactagcttgactcatcttgacatccgtaat |
24781811 |
T |
 |
| Q |
219 |
aataggatctcaggatatatcccaatgggctttggcaggcttcagtatttaggccgggctttattaagtggtaatcagttacacgggcccatccccggct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781810 |
aataggatctcaggatatatcccaatgggctttggcaggcttcagtatttaggccgggctttattaagtggtaatcagttacacgggcccatccccggct |
24781711 |
T |
 |
| Q |
319 |
caatatctcgaatcaaacgtctttcggatcttcatct |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24781710 |
caatatctcgaatcaaacgtctttcggatcttgatct |
24781674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University