View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_45 (Length: 307)
Name: NF7017_low_45
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_45 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 158 - 307
Target Start/End: Original strand, 29336630 - 29336779
Alignment:
| Q |
158 |
taatagtatcttcatagccaaatgatttgacttaagtagttaataattttcaataacagtctaatcaatccggagtaaccgaattcaaaccatggcggta |
257 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29336630 |
taatagtatcttcatagccaagtgatttgacttaagtagttaataattttcaataacggtctaatcaacccggagtagccgaattcaaaccatggcggta |
29336729 |
T |
|
| Q |
258 |
acaaccattggtcaggcttaacttaaattccgatcgaagtggggattatc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
29336730 |
acaaccattggtcaggcttaacttaaatttcgatcaaactggggattatc |
29336779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 7 - 125
Target Start/End: Original strand, 29336479 - 29336597
Alignment:
| Q |
7 |
ctgaaatgaatctctagtataaatgnnnnnnnntatcttaaattattgaattccaagaactaaataacttgtgagactgatggtagataaagtgaattag |
106 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
29336479 |
ctgaaatgaatctctagtataaatgaaaaaaaatatcttaaattattgaattccaagaactaaataacttgtgagattgatggtagataaagtgagttag |
29336578 |
T |
|
| Q |
107 |
ctaacaaccatgacagtac |
125 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29336579 |
ctaacaaccatgacagtac |
29336597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University