View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_51 (Length: 295)
Name: NF7017_low_51
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 286
Target Start/End: Complemental strand, 6479817 - 6479548
Alignment:
| Q |
17 |
tatttaatatttcatctggaagaagaagaaaacataattttagtggaaataatcattttaggtttgatcaaagtgatatttgctttcaatctatgaagct |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6479817 |
tatttaatattccatctggaagaagaagaaaacataattttagtggaaataatcattttaggtttgatcaaagtgatatttgctttcaatctatgaagct |
6479718 |
T |
 |
| Q |
117 |
tgtatactnnnnnnnnttcgcgtatacacgtatccatattgtgttgcacctgcacttgtattacgtatctggaattcataggtttcaatattggtaacta |
216 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6479717 |
tttatactgaaaaaatttcgcgtatacacgtatccatattgtgttgcacctgctcgtgtattacgtatctggatttcataggtttcaatattggtaacta |
6479618 |
T |
 |
| Q |
217 |
taattaacttctgctgatgggaatatatcagagatagtattaatgaaattgaaatataatcgagtattat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
6479617 |
taattaacttctgctgatgggaatatatcagtgatagtattaatgaaattgaaatgtaattgagtattat |
6479548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University