View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_55 (Length: 272)
Name: NF7017_low_55
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 11472658 - 11472432
Alignment:
| Q |
22 |
gggtatgtgtttagttgtgatgcctgtttagatctattagtgttggatatctcgtatgaaatttgtaagtgttagtcatgaaattggatatcttgttttg |
121 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11472658 |
gggtatgtgtttagttgtgatgccagtttagatctattagtgttggatatctcgtatgaaatttgtaagtgttagtcatgaaattggatatcttgttttg |
11472559 |
T |
 |
| Q |
122 |
aaatagttcggtatgaaagtaaattatgaagtttgttttatgatatatgtaaactaatgcagttaaaggaaggtagatgtgaaaaggacaacataagaaa |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11472558 |
aaatagttctgtatgaaagtaaattatgaagtttgttttatg--atatgtaaactaatgcagttaaaggaaggtagatgtgaaaaggacaacataagaaa |
11472461 |
T |
 |
| Q |
222 |
ctaaaatttaattttcttcttggtgacta |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11472460 |
ctaaaatttaattttcttcttggtgacta |
11472432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University