View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_58 (Length: 263)
Name: NF7017_low_58
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 45681983 - 45682231
Alignment:
| Q |
1 |
caaaatcacttgtataatatgctgtacagtatattataattaatttgtcttatcaatgctgagctgggattgtttatatannnnnnnnnnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45681983 |
caaaatcacttgtacaatatgctgtacagtatattataattaatttgtcttatcaatgctgagctgggattgtttatatatgtgtgtgtgtttttgtgta |
45682082 |
T |
 |
| Q |
101 |
nnnngaaattttagtaattgtggcccctggtcccccatttatattctgcagccaagatgacttacataaggaaagaaatgtgtggcattattgtccatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45682083 |
tgtggaaattttagtaattgtggcccctggtcccccatttatattctgcagccaagatgacttacataaggaaagaaatgtgtggcattattgtccatgg |
45682182 |
T |
 |
| Q |
201 |
gattatgtgatattaatc-tttgtaggacatacctttaattaagcttat |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45682183 |
gattatgtgatattaatcttttgtaggacatacctttaattaagcttat |
45682231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University