View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_60 (Length: 255)
Name: NF7017_low_60
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_60 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 2228613 - 2228835
Alignment:
| Q |
17 |
cagaaaagtggttgtttgcgaagaatgttccatgtctatggagattagaggcaacatgggagaaaacgaagaggcaatcttaaagaaacaccgcagttca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228613 |
cagaaaagtggttgtttgcgaagaatgttccatgtctatggagatcagaggcaacatgggagaaaacgaagaggcaatcttaaagaaacaccgcagttca |
2228712 |
T |
|
| Q |
117 |
gggaagtgcgaccctagcaagaagaagaaaccgacttgccccgtgaagcgttgcaaggagattttgacgttttctaacacaagtacttgtaaaacttgcc |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228713 |
gggaagtgtgaccctagcaagaagaagaaaccgacttgccctgtgaagcgttgcaaggagattttgacgttttctaacacaagtacttgtaaaacttgcc |
2228812 |
T |
|
| Q |
217 |
acattaaggtgtgtctcaagcac |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2228813 |
acattaaggtgtgtctcaagcac |
2228835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University