View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_62 (Length: 251)
Name: NF7017_low_62
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 43032460 - 43032684
Alignment:
| Q |
20 |
gatgagacatagttgttgtgtcatggtgattgttttgattgggatgttgttgaattggaaagaaacagaagggataagatttgtgatagatagagatgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43032460 |
gatgagacatagttgttgtgtcatggtgattgttttgattgggatgttgttgaattggaaagaaacagaagggataagatttgtgatagatagagatgaa |
43032559 |
T |
 |
| Q |
120 |
tgtttctcacatgatgttaagtatgaaggtgacactgttcatgtttcttttgttgttattaaggctgattctccttggcattatggtgatgaaggtgtag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43032560 |
tgtttctcacatgatgttaagtatgaaggtgacactgttcatgtttcttttgttgttattaaggctgattctccttggcattatggtgatgaaggtgtag |
43032659 |
T |
 |
| Q |
220 |
atcttgtggtatgttcgttcttttc |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43032660 |
atcttgtggtatgttcgttcttttc |
43032684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 148
Target Start/End: Complemental strand, 23623988 - 23623930
Alignment:
| Q |
90 |
gggataagatttgtgatagatagagatgaatgtttctcacatgatgttaagtatgaagg |
148 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||||||||| ||| ||||| | |||||||| |
|
|
| T |
23623988 |
gggattagatttgtgattgatagagaagaatgtttctctcattatgttcaatatgaagg |
23623930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University